La lecture en ligne est gratuite
Descargar

Compartir esta publicación

También le puede gustar

Véronique Barriel
Pierre Darlu
Approche moléculaire de la phylogénie des hominoidea :
l'exemple de la pseudo êta-globine
In: Bulletins et Mémoires de la Société d'anthropologie de Paris, Nouvelle Série, tome 2 fascicule 1, 1990. pp. 3-23.
Abstract
MOLECULAR APPROACH OF THE PHYLOGENY OF HOMINOIDEA : THE PSEUDO ETA-GLOBIN EXAMPLE Summary. —
Nucleotide sequences from the pseudo eta-globin gene of Pan troglodytes (common chimpanzee), Gorilla gorilla (gorilla), Pongo
pygmaeus (orangutan), Macaca mulatto (rhesus macaque) and Ateles geoffroyi (spider monkey) was compared to the same
orthologous region of Homo sapiens (modern human). Cladistic analysis and pairwise comparison of these sequences
demonstrate that human and chimpanzee are more closely related to each other and support the exclusion of Pongo from a
monophyletic subfamily Homininae (modern human and african apes).
Résumé
Résumé. — Les séquences de nucléotides du gène de la pseudo êta-globine de Pan troglodytes (chimpanzé commun), Gorilla
gorilla (gorille), Pongo pygmaeus (orang-outan), Macaca mulatto (macaque rhésus) et Ateles geoffroyi (atèle) ont été comparées
à celle de Homo sapiens (homme moderne). L'analyse cladistique de ces séquences de nucléotides et leur comparaison 2 à 2,
indiquent que l'homme et le chimpanzé forment un clade et confirment l'exclusion de Pongo d'une sous-famille Homininae
(homme et grands singes africains) monophylétique.
Citer ce document / Cite this document :
Barriel Véronique, Darlu Pierre. Approche moléculaire de la phylogénie des hominoidea : l'exemple de la pseudo êta-globine. In:
Bulletins et Mémoires de la Société d'anthropologie de Paris, Nouvelle Série, tome 2 fascicule 1, 1990. pp. 3-23.
doi : 10.3406/bmsap.1990.1712
http://www.persee.fr/web/revues/home/prescript/article/bmsap_0037-8984_1990_num_2_1_1712Bull, et Mém. de la Soc. d'Anthrop. de Paris, n.s., t. 2, n° 1, 1990, pp. 3-24
APPROCHE MOLÉCULAIRE DE LA PHYLOGENIE
DES HOMINOIDEA
L'EXEMPLE DE LA PSEUDO ÊTA-GLOBINE
Véronique BARRIEL (*), Pierre Darlu (**)
Résumé. — Les séquences de nucléotides du gène de la pseudo êta-globine de Pan tro
glodytes (chimpanzé commun), Gorilla gorilla (gorille), Pongo pygmaeus (orang-outan),
Macaca mulatto (macaque rhésus) et A teles geoffroyi (atèle) ont été comparées à celle de
Homo sapiens (homme moderne). L'analyse cladistique de ces séquences de nucléotides et
leur comparaison 2 à 2, indiquent que l'homme et le chimpanzé forment un clade et con
firment l'exclusion de Pongo d'une sous-famille Homininae (homme et grands singes afri
cains) monophylétique.
Mots-clés : Hominoidea, ADN, pseudo êta-globine, phylogénie, cladistique.
MOLECULAR APPROACH OF THE PHYLOGENY OF HOMINOIDEA :
THE PSEUDO ETA-GLOBIN EXAMPLE
Summary. — Nucleotide sequences from the pseudo eta-globin gene of Pan troglodyt
es (common chimpanzee), Gorilla gorilla (gorilla), Pongo pygmaeus (orangutan), Macaca
mulatto (rhesus macaque) and Ateles geoffroyi (spider monkey) was compared to the same
orthologous region of Homo sapiens (modern human).
Cladistic analysis and pairwise comparison of these sequences demonstrate that human
and chimpanzee are more closely related to each other and support the exclusion of Pongo
from a monophyletic subfamily Homininae (modern human and african apes).
Key-words : Hominoidea, DNA, pseudo eta-globin, phylogeny, cladistic.
I. — INTRODUCTION
Depuis 1758, date à laquelle Linné introduisit le terme de Primates dans la
dixième édition du Systema Naturae, de nombreux travaux consacrés à cet ordre
et émanant de spécialités diverses, se sont succédé. Cependant, le problème de la
phylogénie des Hominoidea n'est toujours pas résolu. Le principal point de désac
cord entre certains auteurs mais également entre certaines disciplines concerne les
relations de parenté de l'homme avec les grands singes (chimpanzé, gorille, orang-
outan). Cinq relations possibles, retenues encore actuellement, sont représentées
en figure 1 :
(*) Laboratoire de Paléontologie des Vertébrés et de Paléontologie humaine. Université Paris VI,
4, place Jussieu, 75252 Paris Cedex 05.
(**) Unité INSERM 155, CNRS, SDI5917, Laboratoire d'Anthropologie biologique. Université de
Paris VII, 2, place Jussieu, 75252 Paris Cedex 05. D'ANTHROPOLOGIE DE PARIS SOCIÉTÉ
Ну P G Pa H Ну Р G Pa H
Ну G Pa P H Ну P G Pa H
Ну P Pa G H
Figure 1 . — Pongo). Cladogrammes Hominoidea (G montrant = Gorilla 5 ; types H = de Homo relations ; Ну de = parenté Hylobate possibles ; Pa = au Pan sein ; P des =
clade grands singes groupe frère de l'homme, singes africains frère de
clade [homme, orang-outan] . chimpanzé],
clade gorille].
— le cladogramme 1 isole l'homme des grands singes sur la base de caractères
morphologiques. Ce point de vue connut un vif succès pendant de nombreuses
années mais est actuellement minoritaire (Kluge, 1983).
— Le 2, clade grands singes africains groupe frère de l'homme, est
soutenu également par de nombreuses données morphologiques (Martin, 1985 ;
Pilbeam, 1986 ; Andrews, 1987).
— Le cladogramme 3, clade [homme, orang-outan], est défendu par Schwartz
(1984) sur la base de caractères morphologiques, génétiques, physiologiques et étho-
logiques partagés par ces deux taxons. MOLÉCULAIRE DE LA PHYLOGÉNIE APPROCHE
— Cependant, le cladogramme 4 (Hasegawa et al., 1987 ; Koop et al., 1986 ; Miya
moto et al., 1987, 1988 ; Sibley et Ahlquist, 1984, 1987) et plus rarement le clad
ogramme 5 (Hixson et Brown, 1986) sont soutenus par de nombreux travaux sur
des données moléculaires. Ils montrent que le primate le plus proche de l'homme
est soit le chimpanzé (cladogramme 4) soit le gorille (cladogramme 5).
Une synthèse de ces différents travaux et résultats peut être trouvée dans l'article
de Holmquist et al. (1988) « Why can't we decide ? ».
Pour étudier les relations de parenté au sein des hominoïdes, nous avons effectué
une analyse cladistique d'une même séquence de nucléotides au sein des Primates,
la pseudo êta-globine. Cette analyse va rechercher les événements évolutifs per
mettant de former des groupes monophylétiques (ou clades) qui contiennent les
descendants d'une même espèce ancestrale.
Depuis 1986, quelques travaux ont déjà été consacrés à cette séquence de nucléo
tides chez les primates Simiif ormes (Catarrhini et Platyrrhini). Elle comprend envi
ron 7 000 paires de base (pb) et représente la plus longue séquence non codante
d'ADN connue actuellement pour l'homme et les primates supérieurs :
— les séquences incomplètes de Homo sapiens, Pan troglodytes, Gorilla gorilla,
Pongo pygmaeus et Macaca mulatto ont été alignées (environ 2 250 bases) par Koop
et al. (1986) ;
— Miyamoto et al. (1987) proposent un alignement des séquences complètes de
Homo sapiens, Pan troglodytes, Gorilla gorilla et Pongo pygmaeus. En 1988, Fitch
et al. ajoutent à ces quatre séquences celle de Ateles geoffroyi, et partiellement
celle de Macaca mulatto (environ 2 700 bases) ;
— en 1988, Miyamoto et al. alignent, dans leur totalité, les séquences de Homo
sapiens et Macaca mulatto ;
— de nouveau en 1989, Koop et al. alignent une portion de 2 373 bases chez ces
six espèces.
L'analyse phylogénétique présentée ici porte simultanément sur ces six espèces
(Homo sapiens, Pan troglodytes, Gorilla gorilla, Pongo pygmaeus, Macaca mulatto,
Ateles geoffroyi) en utilisant les séquences complètes, ce qui n'avait pas encore
été fait jusqu'à présent.
II. — MATERIEL ET METHODES
1) La séquence de nucléotides
La famille de la P-globine des primates catarrhiniens (homme, grands singes
er cercopithécoïdes) est actuellement une des mieux caractérisées en terme de struc
ture, de fonction et d'évolution. Cette famille de gènes comporte 6 locus liés : 5'
— s (embryonnaire) — Gy — Ay (foetal) — \|/T| (pseudogène inactif) — 6 — p*
(adulte) — 3', représentés en figure 2.
La séquence de la pseudo êta-globine (\j/r|) découverte récemment et nommée
pendant longtemps \j/p* ou ц/р1, s'exprimait chez les premiers Euthériens et a per
sisté ensuite comme gène fonctionnel chez les Artiodactyles. Chez les Primates,
toutes les séquences connues partagent une substitution de base (A ► G) dans
le codon d'initiation. Il semblerait donc que ce locus devienne non fonctionnel
chez les protoprimates à environ 60 millions d'années. Ce locus a été perdu chez SOCIÉTÉ D'ANTHROPOLOGIE DE PARIS
les Rongeurs et les Lagomorphes (Goodman et al., 1984 ; Harris et al., 1984 ;
Koop et al., 1986).
Les pseudogènes n'ont pas de fonction connue et ne seraient donc pas soumis
aux pressions de sélection. Ils sont donc susceptibles d'évoluer selon le modèle
d'évolution neutre (Kimura, 1983).
51
Gy A-y \рт| S P
DCHD4CHD
KB 50 I 40 I 30 20 10 0 60
Figure 2. — Cercopithecoidea) La famille de la (3-globine (d'après chez Weiss, les 1987). primates Catarrhiniens (Hominoidea et
2) Les banques de données
Les différentes séquences primaires d'acides nucléiques ont été extraites de la
banque G. E. N.B. AN. K., version 58 (décembre 1988). Le choix des taxons a donc
été dicté par la disponibilité des séquences de primates à cette date.
Sept séquences de longueur variable ont été obtenues : celle à' Homo sapiens
(6999 pb) — qui était stockée sous l'étiquette erronée de macaque dans la version
58 —, de Pan troglodytes (7025 pb), de Gorilla gorilla (7055 pb), de Pongo
pygmaeus (6975 pb) et ďAteles geoffroyi (7143 pb). La séquence du macaque
(Macaca mulatto), longue de 7273 bases, a été introduite « à la main » à partir
des publications originales (Miyamoto et al., 1988 ; Koop et al., 1986), puis vérifiée.
Cette même démarche fut utilisée pour établir la séquence d'un second allèle
de la pseudo êta-globine chez l'homme, nommé Hsa2 (7023 pb), et différant de
Hsal par 3 sites d'insertion (Miyamoto et al., 1987).
Les séquences du macaque et de l'atèle fourniront les extra-groupes nécessai
res à l'évaluation des relations de parenté de l'homme et des grands singes.
3) L'alignement de séquences permet de localiser les parties communes de plusieurs séquences,
afin de mettre en évidence les régions homologues, qui se situent alors dans une
même colonne du tableau I.
Les nucléotides sont de quatre types suivant la nature de la base azotée qui
les constitue : les purines, adénine (A) et guanine (G), et les pyrimidines, thymine
(T) et cytosine (C). On distingue quatre types de mutations ponctuelles :
— l'insertion d'une base ou d'une série de bases.
— la deletion ou de APPROCHE MOLÉCULAIRE DE LA PHYLOGÉNIE
— les substitutions de base : une transition est la substitution d'une base par l'autre
base de même configuration stéréochimique (A* > С ; T« » C), tandis qu'une
trans version est la substitution d'une purine par une pyrimidine et inversement
(A< » С ; A < » T ; G « » С ; G « » T). Bien que les transversions possibles
soient plus nombreuses que les transitions, ces événements mutationnels restent
plus rares car ils nécessitent une modification plus importante de la structure ch
imique. Le rapport transition/transversion est de l'ordre de 2.
L'alignement s'effectue en minimisant les événements mutationnels de telle façon
que des événements partagés par deux espèces soient attribués à un ancêtre com
mun plutôt qu'à une homoplasie (convergence ou réversion).
Il existe actuellement des logiciels d'alignement, mais aucun d'eux n'est réell
ement performant quand il s'agit d'aligner plus de deux séquences à la fois. Le
logiciel utilisé dans notre analyse est MULTALIN de F. Corpet (1988). Les séquen
ces étant trop longues pour un alignement direct, nous avons dû procéder à un
découpage en portions chevauchantes de 1 200 bases, soit huit portions. Lorsque
l'homologie entre les séquences n'était pas optimale, ou différente de celles par
tiellement déjà publiées, l'alignement a été optimisé « à la main ». Cependant l'a
lignement de certaines zones est parfois difficile car il dépend du nombre et de la
nature des événements mutationnels. De plus, des alignements différents, bien que
de même qualité (c'est-à-dire supposant le même nombre et le même type d'évé
nements), peuvent induire des phylogénies différentes. Cette étape de l'analyse est
donc particulièrement importante. Pour les 7 taxons, une série totale de 7 236 bases
a été alignée (Tableau I) avec une homologie jugée optimale.
4) L'analyse cladistique a été réalisée grâce à trois logiciels :
— PAUP (phylogenetic analysis using parcimony), version 2-4, dû à
D.L. Swofford ;
— HENNIG86, versions 1-5, dû à J.S. Farris ;
— DNAPARS, version 3-2 du « package » PHYLIP dû à J. Felsenstein.
Ces logiciels permettent de sélectionner rapidement l'hypothèse de parenté la
plus économique, en se fondant sur le principe de parcimonie qui préfère la solu
tion impliquant le moins de convergences ou de réversions de caractères à une plus « coûteuse ».
Pour cette analyse, tous les sites monomorphes, c'est-à-dire identiques pour
les 7 taxons (Tableau II, site 1) et les événements autapomorphiques (propres à
un taxon) qui n'affectent qu'un seul taxon sur les 7 considérés (Tableau II, site 2)
ont été éliminés : ils ne peuvent apporter aucune information sur les relations de
parenté entre les différents taxons. La série initiale de 7 236 bases est ainsi réduite
à 638 bases, parmi lesquelles certaines deletions ou insertions de plusieurs bases
consécutives (et partagées par au moins deux taxons) ont été considérées comme
un seul événement mutationnel. Seules 311 bases subsistent alors. En fait, une faible
portion (75 bases) de ces 311 bases est réellement informative. En effet, certains
sites (Tableau II, sites 3 et 4) qui montrent 3 bases différentes pour l'ensemble des
taxons n'apportent aucune information sur la phylogénie si on considère que le
macaque et Patèle sont des extra-groupes et que les Hominidae forment un clade,
ce qui a été le cas ici. SOCIÉTÉ D'ANTHROPOLOGIE DE PARIS
l-> 100 l — s J 5 1 s 1 s 3 s % s б 5 6 5 6 5 б 5 fl Hsal B«<2 TC TGG T G CC A AGA TC TGG Ptr T G CC A AGA GgO TC T G A TC CGG T G CC A AGA 5.Ï TG TAA С А CC A CC TGG T A TAG 101> Age -> 200 — 5 o 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 Bsal Bsa2 Ptr 6flO
№u Ppy
Age 201^ -> 300 123456789 l — s о 5 0 5 0 5 0 5 0 5 0 5--—0 5 0 5 0 5 H*al TAGTCAAAGTTGCCACTTCTTTTTCTTCATATCATCGATCTCTGCTCTTAAAGATAATCT GGTTTTGCCTCAAACT. .GTTTGTCACTACAAACTT Hsa2 A T С G AAAGAT С T С G Ptr A T
V." I ? cC čf S? É i с f! SM Hmu Age . .. . ! è ç £S ^?*T Î*TT S Ï I S § Я тт 301-> °
Hsal 500 °1 TCCCCATGTrCCTAAGTAAAACAGGTAACTGCCTCTCAACTATATCAAGTAGACTAAAATATTGTGTCTCTAATATCAGAAATTCAGCTTTAATATATTG TCACGGTCG— 5 10 5 A 2 С AG1 5 Ь 5 0 5 TA 0 5 S AT 5 0 T 5 0 AT 5 0 5 8 Hsa2 Ptr T A Ggo T A T A Мши £РУ С С T A 401^ Age 1 2 3 4 5 6 7 8 9 0 l — s о s о 5 0 5 0 5 0 5 0 5 0 .5 0 5 0 5 0 Bsal T A Hsa2 G T A С G G Ptr G T A С G G T A Ggo G T A С G G T A G T A T G G T G Ppy G A A G G С A A 501-> Mmu Age G G G С G A G A
l — s о 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 Bsal ACCAGCATCCTGAACCTCTAAGTATGAGGACAG7AAGCCTTAAC UTATAAAATAAACTGTTCTTCTCTCTGCCGGTGGAAGTGTGCCCTGTCTA CGG Hsa2 TG С TC T T С TC CGG Ptr TG T T Ggo С ТА T С TG С GA T T Hau Ppy CGG CA G TA С T Age TC GTAAG С ТА TCA 601:> 700 T5 ! — s о 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 Hsal Hsa2 CA A CC Ptr CA С CC Ggo A CC CA A Ими Ppy CC A TT Age TG A CC 701-> 800 ! — 5 J 5 $ 5 1 5 1 5 1 5 t 5 1 5 S 5 1 5 8
Hsa2 Ptr TA CT CG Ggo CT TG TT CC SB TA TTACAGCATTACA CT 3 CA CT 80& 900 i—5 о s 0 s о s о 5 0 5 0 5 0 5 0----5 0 5 0 Bsal GAA. . .TCTCCTATCCTCTTGCTTGAACAGAGCAGCACACTTCTCCCCCAACACTA TTAGATGTTCTGGCATAATTTTGTAGATATGTAGGATT Hsa2 .T TG A G Ptr A В TG A G Ggo Л TG A G TT TT A .T TG A G Ppy Нши AACT G A Age AAACAŤC CA A A
Tableau I. — Alignement des séquences de nucléotides de la pseudo êta-globine de Homo
sapiens (2 allèles : Hsa 1 et Hsa 2), Pan troglodytes (Ptr), Gorilla gorilla
(Ggo), Pongo pygmaeus (Ppy), Macaca mulatto (Mmu) et Ateles geoffroyi
(Age). Pour plus de clarté, seule la séquence de l'homme (Hsa 1) est repré
sentée dans sa totalité et les nucléotides des autres espèces ne sont indi
qués que pour les sites où on observe au moins une différence par rapport
à Hsa 1. MOLÉCULAIRE DE LA PHYLOGÉNIE APPROCHE
|Ml T6ACAT^CTlTT6TTÇMTCATTCAefc6<:UiTCTCCTTTG|TC&e&TUeT&CACTCAC|AC|JUULTeetTTk . AAAAACA^AGTAATAAAACCC
CG С А С АС
ПН ЕЯ il
1001->1100 Ag* ТА CG T О С АA 5 С GT СТ О 5 О 5- __0 « ' 5 ! 0 S Г — -0- ACT АТС A Т 5 g 5 g ТТТТССС(ТГАСТГСССТАвТТТ<?ГГТСТТАПСТССТГТСТТССиСТТСАТССТСвАТАСАССТ<УГПАТТТСТАТТСТА AAAACTGATGAAA ААААСТСАТСААА С А АА? 8 А G С С С ТС АА С ТТСТА ее т т СА С « 5 о 8 5 90 те TG СА Тв 5 0 О 1101->1200 « ! 5 0 5 1 5 0 5 Ô- 5 о -hTCACeACeTCAGGAGATČAAGAČCATCČTGGCŤAACAŤ 5 Ô 5 ■••1 ттвессссвсвсеетеестсАСАССТститсссАссАст LTCAC6AGGTCAGGAGATCAAGACCATCCTCCCTAACAT нм2 есссевссссестсестсАСАСстстит ptr всссссвсвсветесстсАСАсствти TCACGAGCTCA6CAGATCAAGACCATCCTGGCTAACAT TCACCACCTCAGGAGATCAAGACCATCCTGGCTAACAT рру сестбстсствстеесгсАСАСствтитсссАссАстпАоеАсвстсАсетевссесАтссссАСстсАевШ Нви вССТ»»СестеТвССТСАССССТеТиТСССАеСА<ТГГввеАееССААСССеСвТАеАТСАСААСвТСАвСАСАТСАА6АССАТССТСССТААСАТ
1201^*1300 i НМ1 НМ2 Ptr ССТбАААССССАТСТСТАСТАААААТАСАААААА.ТТАеССАбАСАСвСТСССбССТСССТвТАСТСССАССТАСТССеСАеССТвАббСАбеАСААТбб ввТСАААССССеТСТСТАСТиАААТАСАААААА I eCTCAAACCCCATCTCTACTAAAAATACAAAAAA «^САААССССАТСТСТАСТАААААТАСАААААААГГАСССАСАСАСбетебСбеетеССТСТАеТСССАССТАСТССевАСССТСАСССАСвАСААТСС ССТбАиСАССАТСТСТАСТАААААТАСАААААА.ТТАвССАСАвАСССТСбССССТСССТеТАбТСССАССТАСТСбебАеССТСАеССАСбАвААТбв 5 — -0 5 2 0 5 АТАСАААААА.1 0 3 5 . ТТА6ССА6АеАСССТебСевеТСССТСТА6ТСССАССТАСТСС6САСССТСА66САвСАеААТве mGC<aCACATCGT<WTCCeCACCTm6TCCCA6CT»CTCGG6A6GCTGA6CCG6CACAATGC 0- 4 5 5 0 5 6 0 5 7 0 S 0 8 5 9 0 5 Ô О
ССТвАААССТССТСТСТАСТАААААТ .TTAGCCCACCATGCTOCCGGCAACCTCTACTCCCAGCTACTCGCAAGGCTGACCCAGCAGAATGG
1301- > 1400 2 7 Ô 3 4 5 6 8 9
СвТвААССТССААСеСАСАССТ TCTGAACCTCGGAGGCAGACCTTCCACTGAGCACAGATe ССТСААССТСССАСССАСАССТ CCTCUCCTCGGACCCACACCT.CCACTCACCACACATCCCCCI I СвТСААССССССАСССАСАССТТТС TGTGAACCCACGACCCCCACCT.CCA6AGAGA6AC. 5 0 5 0 . вС 5 АвТСАвСССАСАТССССССАСТССАС ACTGAGCAGACATCGCCC 0 5 0 5 — -0 . . TCCAGCCTGGGTGACAAAGCACCACTCCATCTCAAAAATAAAAATT 5 0 5 0 5 0 5 0 5 О . iCTCCATCTCA " ХАТСТСА !АТСТСА
1401-Н500 1 2 345(7890 ! — s о 5 0 5 _0 5 0 5 0 5 0 S 0 5 0 5 0 5 О Hsal AAAAAAAAAGAAAGAAAGAAAGAAAAAAAAA GTGATGAAATTGTGTATTCAA' lTGTAGTCTCAAGAGAATTGAAAACCAAGAAAGGCTGTGGCTTC Н»«2 МАЛЛИИ1М>'11МФАМ<г1Ш№И*.*.ИМ*11 . . GTGATGAAA ТАТ А С Т С G Ptr AAAACAAAGAAACAAAGAAAAAAAA СТСАТСААА ТАТ Т С Т С в Gffo А С Т С G AAAAGAAAGAAAGAAAGAAAGAAAAATAAAGGTCATGAAA .АААСАААААААА CTGAT6AAC CATGAAA TAC А С Т С А Рру А С Т Т G .С А ТС A G
■■al Им2 GGATAACAC T С T тсс CG Ptr TT Т G G CG TC TÉT ТСС TT T С T Т С G CA С ТТ T С T CCA TG щ T CT С T T С С G CA
1 — 5 O 5 O 5 O 5 O 5 O 5 O 5 O 5 O 5 O 5 O
TTTTCAGTTGTAACTTATTCCTATTTGTCAGCATTCAGCTTATTAeCCGCTCCTGGCGA. AGTCCTTGAGAAATAAACTGCACACTGCATGGTGGGGG TCC GT С CTGGATG CGC п CGC с»: С CTGGATC GGG T G в Hsa2 Hsal Ppy Ptr Mau Ggo *»• С А. GT С CTCGACG GGA CGC С G. СТ С CTGGATG GAG CG CA GA С С Т А. GA T GGG T С тёс T " ATGA ~6~ "' С " TG 1701->1800 1 2 3 4 S AGG 7 8 "9 — s о 5 0 5 о 5 0 5 0 5 0 5 0 5 0 5 0 5 l TAGTGTAGGAAAATGGAGGGGAAGGAAGTAAAGTTTCAAATTAA6CCTGAACAGČAAA GČ G TA Ť iGAAGGCCACCTGGATTCTATCAGAAACTCGAA T T A GCC T T G TC A GCC T Ptr Ggo С T A G TC T T A GCC G TC T T G TC A CCC T G G CA. G
— 5 g 5 g ; g 5 q 5 q с 0 . 0 5 0 j 0 5 Hsal GTCCATCTTGCAAAACTTCCTTGCCCAAACCCCACCCCTGGAeTCACAACCCACCCTTGACCAATAGATTCATTTCACTCAGGGACGCAUGGGCTG TGTCCATCTTGCAAAACTTC l 5 g 5 g CTTGCCCAAACCCCACCCCTGGAeTCACAACCCACCCTTGACCAATAGATTCATTTCACTCAGGGACGCAUGGGCTGG ; g 5 q 5 TС A G А q с 0 0 5 0 j 0 5 0 Hsa2 GAGGGAGGCAAAGGGCTGG Ptr GAGAGAGCCAAAGGGCTGG Ggo AAGAGAAGCAAAGCGCTGG GGGAAAGCCAAAGCGTTCG
Aoe
Les deletions de bases sont représentées par des points. Les trois sites poly
morphes de l'homme se situent aux positions 2 750, 2 899 et 3 502 à 3 524.
Certaines insertions autapomorphiques, de longueur importante, n'ont pas
été indiquées : chez le macaque, 331 bases entre les positions 1 028 et 1 029
(Miyamoto et al., 1988) ; chez l'atèle, 458 bases entre les positions
3 083-3 084 et 316 bases entre les positions 6 636-6 637 (Fitch et al., 1988). •
SOCIÉTÉ D'ANTHROPOLOGIE DE PARIS 10
1901- > 2000
TCAATAGATTCATTTCACT TCAATGGATTCATTTCACT j TCAACAGATTCATTTCACT ТС AATAGATTCATTTCACTGGGAGAGGCAAA s о 12 5 0 A CGC G « 6 G G 6 G G С 5 G G A G G 3 0 . GGGCTGGGGGCCA6AGAGGAGAAGTAAAAAGCCACACATGAAGCAGCAATGCAGGC 5 4 0 5 0 5 5 0 6 5 7 0— -5 о 8 5 ATGCTTCTGGCT 9 0 5 0 0 Heal Ha«2 GTA CAA G GC С Ptr CGA G GC С CflO GTA CAA G GC T ATG CAG G GC С AC. AAG A GT С GTA CAG G АС С S 01234567 г 5 о 5 0 5 0 5 0 5 0 5 0 5 0 5 Ô 5 0 5 Ó CATCTGTGATCACCAeGAAACTCCCAGATCTGACACTGTAGTGCATTTCACTGCTGACAAGAAGGCTGCTGCCACCAGCCTGTGAAGCAAGCTTAAGGTG
Ptr Ggo JtS ? I Hi ce it
i г Ш IS
7 ! 5 о 5 0 5 0 5 0 5 0 5 0 5~ -0 5~ _0 5 о 5 о TTC G GA TC CG TG G GG T TG G GG CA 2201=>2300. Hsa2 HMl Çgo Кши Ptr Age РРУ CG G GG T CG TG A CA TA A AG с AG
1 5 0 5 0 5 0 5 '0 5 0 5 -0 5 0 5 0 5 0 5 0 B*al Hsa2 С 6 С А T С AT Ptr С G С А T С AT Ggo С G С А T С AT С G A A С G CT № С G T С G T T С TA *»•. 2301->2400 1 2 3 4 5 6 7.8 9 0 l 5 о 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 HMl TCTG<MCTCTGACTGTGCAATAAT(><MCAACCCCAAA«TCAAGGCACATGeCAAGAAGGTGCTGATCTCCTTCGGAAAAGCTCTTATGCTCACGGATGAC Hia2 С G CC CAG CCT CGC AC G Ptr С G CCТСС G Ggo С G CCCCT CGC AC G С G CT... CGG AT G sss С G ТС AAG CCT CGA G T .CC A . С CAG 2401- Age > 2500 3 4 5 6 8 ! 5 о 5 0 5. 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 B*al H«a2 CA A G TG CG Ptr CA lcc ïc
a n ï G 8 Ы
Я Vc ь î S* II Я
TCTTTACCCTTAGATATTTGCACTATGGGTACTTTTGAAAGCAGAGGTGGCTTTCTCTTGTGTTATGAGTCAGXTATGGGATATGATATTTCAGCAGTGG AGATTGT TC T ^ A ATGA . CAG GA GT ATGA GA GC ATAA CAG 2601- Bsal Baa2 РРУ Age Ggo №u Ptr > 2700 GA GT ATGA CAG GC GT ATGA CAG AA CT ..GG TGA 6 7 8 9 0 ! 5 о 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 Hsal GAT TTTGAGAGTTATGTTGCTGTAAATAACATAACTAAAATTTGGTAGAGCAAGGACTATGAATAATGGAAGGCCACTTACCATTTGATAGCTCTG Hia2 С G AA A A TG AG С А Ptr С G AA A A TG AG С А Ggo С G CG A A AG С А T G AA A A TG GG С А Паи CGTT С С AA G T TG AA G A Age CGAA С С CC A A CA AG С С 2701->2800 8 1 5 о 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 Hsal AAAAACACATCTTATAAAAAATTCTGGCCAAAATCAAACTGAGTGTTTT.GGATGAGGGAACAGAAGTTGAGATAGAGAAAATAACATCTTTCCTTrGGT H Isa2 AAAA A A A CAACAACAA TTT CAGCAGCAC AAAAAAAAA T TT TT T Ptr Ggo .AGA A CGG T CAGРРУ Hau AGAC ATAA T TGG AGG TT Age A A T A G TGA T TCA G A A С G 2801->2900 5 -Q 1 5 о 2 5 3 0 5 4 0 5 0 5 5 6 0 5 0 7 5 8-9 0 5 0 5 0
CAGCGAAATTTTCTATAAAAATTAATAGTCACTTTTCTGCATAGTCCTGGAGGTTAGAAAAAGATCAACT . GAACAAAGTAGTGGGAAGCTGTTAAAA . G A A T G AC A G A A T A GC A G A* II ÏS S î S TT A. G T G A A T С G G Age CT AC G G APPROCHE MOLÉCULAIRE DE LA PHYLOGENIE 11
2901->3000 1234567890 ! s о 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 AG6ATTGTTT . . CCCTCCCUTGATCATGCTATACTTTTGTACCCATCCTACACCiTTCTTTGrrXTGACTGTTTGCGAAAATTCTATCTATCTATCTAT С Св АТСТАТ Ptr с ce a s ATGTAT С СТ Ggo с тс G U Л к A А TG ТА в А С т те AC* с тс о эооРшоо. I — 5 о 5 о 5 0 5* — 0 5 0 5 Q~r-5- 0 5 0 5 0 5 О GTATGTGATGACTGGGCACTTATCCTATCCATTACTGTTCCrrCAAGTACTATTATCCTACTTTTTAAAAGCACeAAGTCTCTAAAAAAAAAATGAAACA CTATGT С А TAC Т А CCA С ААА H«tl H*a2 Ggo Ptr вт. С А l l Т А С6А С .АА С А СТ. TAC Т А CGA С А Т А CGC Рву Ав в А С С А А Hau ТАТ САС А С ACT 1 ТСС 3101?>3200 7 1 ___ — О 5 О 5 О 5 0 5 0 5 0 5 0 5 0 5 0 -5 О AT. Haal CACAATATGTTCCCGTACTG&GTTGGCATACCUGTAACAeAAGCATACGACACAATCCGACCTCCACCCCTGCCACTCATATTCAAGCTGATA Hsa2 А А Т С CA CG G A Ptr А А С С GA GC A A 6go TÁÁŤ А А С С CA GG G A TUT А А С G CA CG С G ТААТ С в С G AG CG G G ТААТ GA CA G G Z 0
TCTAGCCCATAATGCTG ! — s GС о 5 0 5 3 0 5 4 0 5 ACAGTTGCTC 0 5 5 AAACTCTGGTCAAAAAGGATGTAACTGTT 6.. 0 GС 5 0 CTC GTGGTACT G S TG СТА 0 G T ATATCTATTTACTGC A 5 С 0 ТС 5 0 A Hsal Hsa2 Ptr С Geo T С G T G T С ЙХ Т ÍÁCŤTÁČČŤŤŤGŤGAGAmÁGÁČŤ".G G G AC G T G G T G TACTTACCTTTCTGAGAAGAAGACTCAG T A АА A С G T T 330ï->3400 12345(7890 ! — s о 5 0 5 0 5 0 5 0 5 0 5-*— 0 5 0 5 0 5 0 Hsal ACTCCACCTrCAGGCCTTCTATTCACTATCTACCATTTTCTTtTTTATCTTCACTCCCTCCCCACCTCTTAGGCAACGTGATATTCATTCTTTTGCCAAC ~H«a2 С TC T T G TC G TC T T G 4 TG Ptr G TC T . G ' TC Geo G TC T . G TC SE A TC T A TA С AT С С GG 401>3 Age 01234567890 I — s о 5~"0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 О 0 CCACTTCACCGAGGATTTTACCCTACACATACAGGCTTCTTGCCACTAACTAACAAAT TAATCCTGTAGCCCACAAG.ACCACTGAGTTCCC CGCG G T G TT СТА ТА TAA A A G.ACC С TTC С СТА TA Ptr Св С G TT GTATGCTGTGGTTAA A С С Cgo CG G G CT СТА TA TCCTGTCGTTAA С ТСС С CG G G TT GGA TA CGACC С TTC С Ppy Мши AA . G TT CCA CC TGCTCTCCCTAA T С CG G G CA AAC CA ...TT T CAA T 3501->3600 1234567890 ! — 5 о 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 О Haal Т CTCCACTATGTTTGTACCTATGTCCCAAAATCTCATCTCCTTTAGATCCCGGAGGTTGCGGACAAGAGCAGTATCC Н«а2 TCTCCACTATGTTTGTACCTA.TG CI T CATC TGGGTG G Ptr TCTCCACTATGTTTCTACCTA.TC ..T CCTC G Cgo TCTCCACTATCTTTCTACCTACTG CT T CC T С T 6 CCT G 6 Ppy С GT T CA T С T G CGT G G Ими T CT TG T С G CAC A G Age TGTCCACTGTCTTCGTACCTGCTG GT С TA G С T A TGT G A 3601Ï>3700 12345678 l 5 о 5 о 5 0 5 0 5 0 5 0 5 0 5—"0 5 0 5 0 Hsal TCCCTGCTGATTCAGTTCCTCCATGATAAAAATACAATAAACAAATATGCTCTCTAACAAATATCATTGTACTCTTTTTCTCTCTTTATATTTTACCCTC Hsa2 ïcc стст G CTC A CCC cc Ptr G TTC AGgo CTC стст вA CCC T T A G TTC AG TTC A CAT С С С A TAT G TGT 3701->3800 l — 5 о 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 Rtal Hta2 CG AG TG GGAC Ptr AG TG 600 CG AGGGAC CA AG TC tou Ppy CC AA CA GGGT TG Agt GG TG AAAT 3801->3900 ! — 5 о 5 0 5 0 5 0 5 0 5 0 5 0 5— r;0 5 0 5 0 H«al GAGAGAACTC6TGGGT6GATTTAGTGGGCTAGTTACTCCTAGGAAGCGGAAATCCTCTCTAGAATAAGACAATCTTTTTACAGAAACCGAC6TCAATGGA Hia2 GGA ACG GG AA G CT С TC Ptr GAA AGA GG AA G CT G TC GflO TGA AGG GG AA G CT С TC CGC ACG CA AA G CT G CC Мши ЕРУ AGG GG AA G TC T GC Age 6GA GCG CC A CT G CC